rs1433769 chr11:74712468 G>A
- Sequence
ggagaggtgaggccccccagagtc[G/A]gcatcagacatgaggacactccct
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | -1.91 | 1.84 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, height, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), parkinsons disease, tetrology of fallot, transmission distortion, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood