rs14490 chr1:88935930 T>G
- Sequence
tactgagaggttaaacatctcaca[T/G]ttcttatccactatgttatgctga
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.89 | 0.33 | 1.35 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), irritible bowel syndrome, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood