rs1452386 chr15:73856646 G>A
- Sequence
aggaagctttagggaggaaggaat[G/A]ttctttgaagtggtgtcaaccaga
- ASB in cell types
- HEK293 (embryonic kidney) ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- ZIC2_HUMAN TFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.42 | n/a | 1.50 | n/a | n/a | |||
| TFE2_HUMAN | -2.17 | 1.96 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood