rs1454535 chr2:220365201 A>G
- Sequence
tgtctctgcttcaagtcctggcaa[A/G]cattttctctccaagttaccatga
- ASB in cell types
- foreskin keratinocyte keratinocytes
- ASB for transcription factors
- CTCF_HUMAN P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 2.68 | 2.50 | n/a | No Hit | |||
| P63_HUMAN | -1.77 | 1.93 | 1.33 | 4.16 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP asthma, maternal transmission distortion, partial epilepsy, transmission distortion, urinary albumin-to-creatinine ratio