rs145562362 chr6:108558626 C>A
- Sequence
cgcgcgtcacttgagtgacgggcg[C/A]tgcgcaaagcccggagcccggagg
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -1.42 | 1.22 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1