rs1456893 chr7:50230076 G>A
- Sequence
accatgacatgtcacggaagagaa[G/A]aattcaggaatcaaatttacctag
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.67 | 2.31 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease (left hippocampal grey matter density), alzheimers disease (right hippocampal grey matter density), crohns disease, crohns disease, combined control dataset, hypothyroidism, irritable bowel disorder, irritible bowel syndrome, mitral annular calcium, prop taste detection threshold, selective immunoglobulin a deficiency (igad), systemic lupus erythematosus (sle), triglycerides change with statins, urinary albumin-to-creatinine ratio
PheWAS abnormal findings on radiological breast exam, acquired hypothyroidism, acute pericarditis, age-related macular degeneration, allergic rhinitis, ascvd, benign neoplasm of lip, oral cavity, and pharynx, breast conditions, congenital or relating to hormones, calcaneal spur, exostosis nos, cancer, suspected or other, cardiac and circulatory congenital anomalies, cardiac congenital anomalies, cardiac defibrillator in situ, cervicitis and endocervicitis, chronic airway obstruction, chronic kidney disease, stage i or ii, chronic osteomyelitis, chronic sinusitis, congenital pigmentary anomalies of skin, crystal arthropathies, cyst and pseudocyst of pancreas, cystic kidney disease, diseases of esophagus, diseases of the larynx and vocal cords, disorders of parathyroid gland, encounter for long-term use of antiplatelets/antithrombotics, epiphora, esophagitis, gerd and related diseases, essential tremor, fracture of radius and ulna, fuchs dystrophy, gram positive septicemia, heart failure nos, hemorrhoids, hydronephrosis, hyperparathyroidism, hypertrophy of breast (gynecomastia), iatrogenic hypothyroidism, kidney replaced by transpant, kyphosis (acquired), lack of coordination, methicillin sensitive staphylococcus aureus, nerve plexus lesions, noninfectious disorders of lymphatic channels, other aneurysm, other benign neoplasm of connective and other soft tissue, other specified intestinal malabsorption, other specified peripheral vascular diseases, pain, swelling or discharge of eye, peripheral retinal degenerations, poisoning by other anti-infectives, polyarthropathy or polyarthritis involving multiple sites nos, random mental disorder. ignored for now, retinal disorders, scleritis and episcleritis, secondary/extrinsic cardiomyopathies, staphylococcus infections, strabismus (not specified as paralytic), type 1 diabetes, type 1 diabetes nephropathy, viral hepatitis, viral pneumonia, voice disturbance, wheezing