rs1456896 chr7:50264865 C>T
- Sequence
tctgcagagaggacagaggtctga[C/T]gatgcagggttcatattgaatgag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.32 | 0.64 | 1.32 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease (left hippocampal grey matter density), alzheimers disease (right hippocampal grey matter density), college completion, coronary artery disease (cad), crohns disease, inflammatory bowel disease, irritible bowel syndrome, mitral annular calcium, triglycerides change with statins, ulcerative colitis