rs1460818 chr13:32285017 C>A
- Sequence
ttcttaacatcttggcttcttgat[C/A]ttttgtttcctcattttgagaaaa
- ASB in cell types
- primary endothelial colony-forming cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary endothelial colony-forming cells | 1.21 | -0.51 | 1.50 |
Items per page:
1 – 1 of 1