rs1461062 chr12:74437646 G>A
- Sequence
tgttcttttttctccccttctgtt[G/A]caagtagaaaggtaacctgatagt
- ASB for transcription factors
- SIX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SIX2_HUMAN | 1.25 | 0.07 | 1.22 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, total cholesterol, triglycerides