rs146106281 chr17:81927264 G>A
- Sequence
ccgagtccgctccgcactcgcccg[G/A]ctccgcgggtccgccgccgcccgc
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.12 | -0.98 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen