rs1461103 chr3:159805299 C>T
- Sequence
gcagcacccaaggaactggggctc[C/T]tagcctgactcacaactcttggaa
- ASB in cell types
- liver epidermal keratinocytes HEK293 (embryonic kidney) HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | n/a | 1.87 | 2.00 | |||
| epidermal keratinocytes | -1.88 | 1.95 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.31 | 0.52 | 1.46 | |||
| HUES64 (embryonic stem cells) | 0.86 | -0.18 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol
GTEx eQTL Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Lung