rs1463940 chr1:63746139 A>G
- Sequence
cctttacaacagaaaagtgtcaaa[A/G]cccttttgcaagtgggtcagtggg
- ASB in cell types
- HEK293 (embryonic kidney) cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.23 | 0.86 | 1.98 | |||
| cranial neural crest cells | 1.64 | -0.01 | 2.00 |
Items per page:
1 – 2 of 2