rs1465813 chr2:86498971 G>C
- Sequence
aaagctttgaaagctgtatgattt[G/C]tcagttgtgggattggaaaaaggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- PKNX1_HUMAN GATA3_HUMAN SMCE1_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 2.53 | -2.78 | 1.33 | n/a | No Hit | |||
| GATA3_HUMAN | 2.53 | -0.34 | 1.42 | n/a | No Hit | |||
| SMCE1_HUMAN | 2.17 | -2.21 | 1.33 | n/a | n/a | |||
| REQU_HUMAN | 2.03 | -2.06 | 1.33 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), hdl cholesterol, ldl cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood