rs146689 chr5:97420985 G>T
- Sequence
aggctcaaagtcttacagcttgtt[G/T]tgtttcatactttgtcagatcatc
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.92 | -0.35 | 1.90 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, eye color, fasting triglycerides, ln, neuroticism, spine bone mineral density (bmd), triglycerides (iauctg)