rs1467636 chr1:29461222 T>A
- Sequence
aagtcccatccctgtgctcctggc[T/A]cctcttcccatctggctcttccct
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 0.95 | 0.01 | 1.50 |
Items per page:
1 – 1 of 1