rs1472146 chr7:128863888 T>A
- Sequence
gacctgggaggctgttatctgcca[T/A]tctctaagctgtctggtaaagtga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | 0.33 | 1.52 | |||
| HEK293 (embryonic kidney) | -0.38 | 0.73 | 1.93 | |||
| foreskin keratinocyte | 0.03 | 1.78 | 2.50 | |||
| GM12878 (female B-cells) | 0.27 | 0.47 | 1.26 |
Items per page:
1 – 4 of 4