rs1475521 chr13:114115603 T>G
- Sequence
tcatgtccacgccctctgcaggcc[T/G]cgtgtccccctcgctgtcgcctgc
- ASB in cell types
- CD14+ monocytes SUM159PT (pleiomorphic breast carcinoma) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- STAT1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 2.62 | 2.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.00 | 1.44 | 1.61 | 1.62 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood