rs1477822 chr15:27512429 G>A
- Sequence
gagtgaatgtttgttgagcacagt[G/A]cactgcaggtggagctgcttgtta
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | 1.75 | -1.01 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol withdrawal symptoms, birth weight, cystatin c in serum, height, salmonella-induced pyroptosis