rs148751051 chr19:4872616 A>G
- Sequence
attttttgtatttttagtagagac[A/G]gggtttcaccatgttaaccaggat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.86 | -0.24 | 2.02 | |||
| K562 (myelogenous leukemia) | 0.81 | -0.14 | 2.00 | |||
| foreskin keratinocyte | 0.82 | n/a | 2.33 | |||
| GM12878 (female B-cells) | 0.37 | 0.61 | 1.26 |
Items per page:
1 – 4 of 4