rs1491940 chr12:40204542 A>T
- Sequence
aatcttgcgcaatcttcacttctt[A/T]attgctacttctgccaactaccca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.60 | -0.38 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol change with statins, homa-ir, microalbuminuria, prop taste detection threshold, salmonella-induced pyroptosis, tardive dyskinesia, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Pituitary, Spleen, Whole_Blood