rs1492905 chr1:172758424 G>T
- Sequence
gatgaggatggggttgataatgag[G/T]aacaacaaagagagaggatgattc
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.13 | -2.94 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1