rs150298 chr15:89399809 G>A
- Sequence
ctactcctctggcccggagaccca[G/A]gacctcgtccgcactccaactctc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) 22RV1 (prostate carcinoma) GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.64 | -0.05 | 2.00 | |||
| GM12878 (female B-cells) | 0.26 | 0.80 | 1.33 | |||
| 22RV1 (prostate carcinoma) | 1.60 | -1.24 | 1.00 | |||
| GM23248 | -0.82 | 1.62 | 1.42 |
Items per page:
1 – 4 of 4