rs150642270 chr11:44066209 G>C
- Sequence
ctagtccgggcgcgctgagcgcag[G/C]ggggcgctgtcctcacccacgcgt
- ASB in cell types
- T47D (invasive ductal carcinoma) AG09319 (fibroblasts) human cardiac myocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.63 | -0.29 | 1.31 | -5.02 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
