rs150838935 chr7:117157625 A>G
- Sequence
ttaatctactgaatagaattattt[A/G]ctattacccatgtgaatgtggaag
- ASB in cell types
- SK-N-SH (neuroblastoma) Tet21N (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.23 | -0.16 | 2.00 | |||
| Tet21N (neuroblastoma) | 1.32 | -1.17 | 2.00 |
Items per page:
1 – 2 of 2