rs151452 chr21:27268388 A>T
- Sequence
tacatagtaaaaacttcaaagtgc[A/T]actttttgaaaatagctttgtgat
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | -1.17 | 2.43 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1