rs1516617 chr11:83816564 A>G
- Sequence
tacaggaggttcatatgagataat[A/G]catgcagtgtaaggtgatgttatt
- ASB in cell types
- IPSC-derived bipolar neuron bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | -1.13 | 1.40 | 1.00 | |||
| bipolar neuron | -1.64 | 1.45 | 1.33 |
Items per page:
1 – 2 of 2