rs151765 chrX:132613215 G>C
- Sequence
gccatgcctggaaactgcacactc[G/C]ctgctcgtaggcagcctgccaagg
- ASB in cell types
- HEK293 (embryonic kidney) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.31 | 0.99 | 1.98 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 1.97 | -2.25 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic