rs1517938 chr4:137055309 G>A
- Sequence
taacaatcttagtaaccaatgtaa[G/A]gttttaagttttcattatataaga
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.40 | 0.84 | 1.59 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, total cholesterol