rs1518182 chr4:167622960 T>C
- Sequence
gaaagaagtccaatcagactgaaa[T/C]tgtatcacttcagcaagcagagaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.86 | -0.17 | 1.96 | |||
| A549 (lung carcinoma) | 0.48 | 0.54 | 1.16 | |||
| CD34+ stem cells-derived erythroblasts | n/a | 2.31 | 2.50 |
Items per page:
1 – 3 of 3