rs1528492 chr17:59620847 C>G
- Sequence
gctatgtcaatctcagagtgtgtg[C/G]ggtcaaactccctaaggaaactcg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- HDAC1_HUMAN PKNX1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | -1.01 | 1.46 | 2.00 | n/a | n/a | |||
| PKNX1_HUMAN | n/a | 1.40 | 2.25 | n/a | No Hit | |||
| ESR1_HUMAN | -3.64 | 2.04 | 2.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, fasting insulin, ldl cholesterol, refractive error, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood