rs1530562 chr2:119291153 A>G
- Sequence
tctccgcgtaacgaggctctgcta[A/G]tatggcaggaaaggtgtcataccg
- ASB in cell types
- A549 (lung carcinoma) gastroesophageal sphincter gastrocnemius medialis upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN SNAI2_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.57 | -0.08 | 1.51 | n/a | No Hit | |||
| RAD21_HUMAN | 1.19 | -0.14 | 1.91 | n/a | n/a | |||
| SNAI2_HUMAN | -1.46 | 2.18 | 1.33 | n/a | No Hit | |||
| SMC3_HUMAN | 1.20 | -0.04 | 2.05 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, college completion, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood