rs1530820 chr7:37901650 G>A
- Sequence
gtggaacacagcagcaagaggtag[G/A]catgtaaggactggggttagcagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.87 | -0.46 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), fasting blood glucose, hip bone mineral density (bmd), longstanding arthritis, rheumatoid arthritis, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Whole_Blood