rs1535948 chr6:33816106 G>A
- Sequence
ggagcctgggaaatgtagtttgtg[G/A]gggcagcacactgtgatccattgc
- ASB in cell types
- VCaP (prostate carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -1.19 | 1.84 | 3.00 | |||
| HepG2 (hepatoblastoma) | 1.02 | -0.33 | 2.00 |
Items per page:
1 – 2 of 2