rs1536621 chr13:110555989 T>G
- Sequence
aatgtttgtttagcaaaactcaca[T/G]ggtacttcctcattctggccactg
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.45 | 1.27 | 1.33 | n/a | No Hit | |||
| IKZF2_HUMAN | -0.45 | 1.47 | 1.33 | n/a | n/a | |||
| FOXA1_HUMAN | 1.02 | 0.02 | 1.46 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), lp-pla2 activity, parkinsons disease, refractive error, sporadic creutzfeldt-jakob disease, total cholesterol change with statins, triglycerides change with statins