rs153739 chr3:64174453 A>G
- Sequence
tagcttcggttgaccgacatgtgc[A/G]caccatcctgtctctgcagtcctt
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.12 | -0.06 | 1.61 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, sporadic creutzfeldt-jakob disease, transmission distortion