rs153753 chr5:171757967 A>G
- Sequence
gcttgatctagggattcagatgac[A/G]tcattggctccctctctttctttt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- ATF7_HUMAN ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | n/a | 3.66 | 1.33 | n/a | n/a | |||
| ATF2_HUMAN | n/a | 2.11 | 1.33 | 13.14 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP chronic lymphocytic leukemia outcome in response to chemotherapy (progression free survival), fasting insulin, height, hip bone mineral density (bmd), homa-ir, salmonella-induced pyroptosis, spine bone mineral density (bmd), tetrology of fallot