rs1540180 chr11:77548529 C>T
- Sequence
gaacccgaagagaacgctgttctt[C/T]ttcattttgaattttcaactccgc
- ASB in cell types
- A549 (lung carcinoma) K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- RAD21_HUMAN SMC3_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.10 | 1.13 | 1.69 | n/a | n/a | |||
| SMC3_HUMAN | -0.06 | 1.01 | 1.87 | n/a | n/a | |||
| NFIC_HUMAN | 2.18 | -1.75 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis