rs154067 chr5:138514370 A>G
- Sequence
gagtttgagactggcctgggcaac[A/G]tagcgaaacactgtctctacaaaa
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 0.91 | -3.56 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Whole_Blood