rs1542818 chr7:45938057 G>T
- Sequence
tgcgtagaatgtgtgtgttgtggt[G/T]tatgttgtatgttgtggtgtgtgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.28 | 0.79 | 2.07 | |||
| GM12878 (female B-cells) | 0.27 | 0.83 | 1.34 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), height, parkinsons disease