rs1547110 chr1:116476481 T>G
- Sequence
tgagtatgctcagctgcggtttgg[T/G]gttttttattagtgaatggcttag
- ASB in cell types
- PC3 (prostate carcinoma) VCaP (prostate carcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- ANDR_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.21 | -0.15 | 1.98 | n/a | No Hit | |||
| GATA1_HUMAN | 1.26 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2