rs1552351 chr12:93767219 G>A
- Sequence
aacaaatttatttatgatttgttc[G/A]tatcctcctccttccagagattgg
- ASB in cell types
- K562 (myelogenous leukemia) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.28 | 0.62 | 2.00 | |||
| RWPE1 (prostate epithelial cells) | 1.89 | n/a | 1.33 |
Items per page:
1 – 2 of 2