rs1554 chr9:87518811 C>T
- Sequence
ttggtgcctgaagagtctggcccg[C/T]gcccagtatttggcagctgtaaaa
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -1.87 | 2.22 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, hypertension (early onset hypertension), ldl cholesterol change with statins, longstanding arthritis, prostate cancer aggressiveness, spine bone mineral density (bmd), total cholesterol change with statins