rs1558488 chr4:10325790 A>G
- Sequence
acttaagagagcacatgggtcccc[A/G]tgattcataagtgaataacgttga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | -1.52 | 2.11 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diabetic retinopathy in type 2 diabetes mellitus, irritible bowel syndrome, ldl cholesterol change with statins, schizophrenia, serum urate, total cholesterol change with statins, uric acid, variant creutzfeldt-jakob disease
GTEx eQTL Brain_Cortex, Esophagus_Mucosa, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid