rs156031 chr5:132190497 A>G
- Sequence
tatatattaagcccctgagattta[A/G]ggattattactacagaaaaagccc
- ASB in cell types
- adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -1.34 | 1.56 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, asthma, cystatin c in serum, myasthenia gravis, prop taste detection threshold, years of education
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid