rs15651 chr1:110338323 G>C
- Sequence
acccggagtacttgggcgggaacg[G/C]gtagctcgcgggagagacgggctc
- ASB in cell types
- HepG2 (hepatoblastoma) cranial neural crest cells GM12878 (female B-cells)
- ASB for transcription factors
- AP2A_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 0.20 | 2.36 | 1.75 | n/a | No Hit | |||
| CREB1_HUMAN | -0.37 | 1.22 | 1.37 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, microalbuminuria, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid