rs15656 chr2:70293714 C>T
- Sequence
cgcacggctttcctcacgctcccg[C/T]tgtaggcccggcgtcttgcgtctg
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes VCaP (prostate carcinoma)
- ASB for transcription factors
- STAT1_HUMAN GABPA_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.37 | -0.78 | 2.50 | n/a | No Hit | |||
| GABPA_HUMAN | -0.36 | 1.13 | 1.83 | n/a | No Hit | |||
| REQU_HUMAN | -1.17 | 1.88 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood