rs157198 chr1:28877395 T>C
- Sequence
taccggctatatcttgcattagca[T/C]ccttgcttagttcctgctctattc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) neutrophils MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.25 | 1.01 | 2.07 | |||
| neutrophils | 2.70 | 0.41 | 1.67 | |||
| MM1.S (plasma cell myeloma) | 1.51 | 0.27 | 1.37 |
Items per page:
1 – 3 of 3