rs1572905 chr9:107422364 G>A
- Sequence
gcccagactgagcacgtgatggca[G/A]aggaaaggaagccctgcttcctcc
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) VCaP (prostate carcinoma) human villous mesenchymal fibroblast cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | -0.26 | 0.86 | 2.00 | |||
| VCaP (prostate carcinoma) | 1.95 | -3.87 | 3.50 | |||
| human villous mesenchymal fibroblast cells | -1.93 | 2.00 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins