rs157413 chr5:67998769 A>G
- Sequence
ctgcttacgcacaccctgggacac[A/G]ggaaaggcatgttaaagccagtgg
- ASB in cell types
- sigmoid colon tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| sigmoid colon | 2.52 | -2.76 | 1.33 | |||
| tibial nerve | 1.62 | -1.87 | 1.33 |
Items per page:
1 – 2 of 2