rs1574373 chr15:57607861 G>C
- Sequence
atttcgtcaccatgtcctggccag[G/C]ttcctggcatgagtcactgagggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | -2.72 | 2.28 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Testis, Thyroid